Review



grnas targeting non targeting controls  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc grnas targeting non targeting controls
    Grnas Targeting Non Targeting Controls, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grnas targeting non targeting controls/product/Addgene inc
    Average 94 stars, based on 2 article reviews
    grnas targeting non targeting controls - by Bioz Stars, 2026-05
    94/100 stars

    Images



    Similar Products

    grnas targeting non targeting controls  (Addgene inc)
    94
    Addgene inc grnas targeting non targeting controls
    Grnas Targeting Non Targeting Controls, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grnas targeting non targeting controls/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    grnas targeting non targeting controls - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    luciferase  (Addgene inc)
    93
    Addgene inc luciferase
    Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/luciferase/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    luciferase - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    non targeting control  (Addgene inc)
    94
    Addgene inc non targeting control
    Non Targeting Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting control/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    non targeting control - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    nontargeting control grna  (Addgene inc)
    94
    Addgene inc nontargeting control grna
    Nontargeting Control Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nontargeting control grna/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    nontargeting control grna - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    zap tttgtggtgttggagaccgg  (Addgene inc)
    94
    Addgene inc zap tttgtggtgttggagaccgg
    Zap Tttgtggtgttggagaccgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zap tttgtggtgttggagaccgg/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    zap tttgtggtgttggagaccgg - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    non targeting control grna pairs  (Addgene inc)
    94
    Addgene inc non targeting control grna pairs
    Non Targeting Control Grna Pairs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting control grna pairs/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    non targeting control grna pairs - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    non targeting control grna  (Addgene inc)
    94
    Addgene inc non targeting control grna
    Non Targeting Control Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting control grna/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    non targeting control grna - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    addgene plasmid  (Addgene inc)
    93
    Addgene inc addgene plasmid
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/addgene plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier

    Image Search Results